Skip to main content
Download PDF

miR-3154 promotes glioblastoma proliferation and metastasis via targeting TP53INP1

Cell Division volume 19, Article number: 30 (2024) Cite this article

Abstract

Glioblastomas (GBM) are most common types of primary brain tumors and miRNAs play an important role in pathogenesis of glioblastomas. Here, we reported a new miRNA, miR-3154, which regulates glioblastoma proliferation and metastasis. miR-3154 was elevated in glioblastoma tissue and cell lines, and its elevation was associated with grade of glioblastomas. Knockdown of miR-3154 in cell lines weakened ability of proliferation and colony formation, and caused cell cycle arrested and higher percentage of apoptosis. Knockdown of miR-3154 also impaired ability of migration and invasion in glioblastoma cells. In mechanism, miR-3154 bound directly to Tumor Protein P53 Inducible Nuclear Protein 1 (TP53INP1), down-regulating TP53INP1 expression at both mRNA and protein level. Silence of TP53INP1 reversed the effect of miR-3154 knockdown on proliferation and metastasis of glioblastoma cells. These findings show that miR-3154 promotes glioblastoma proliferation and metastasis via targeting TP53INP1.

Introduction

Glioblastomas (GBM) are the most common types of primary brain tumors [1]. Glioblastomas account for about 28% of all primary brain tumors and 80% of all malignant brain tumors [2]. Glioblastomas are also a major cause of brain tumor related deaths [3]. The mainstay treatments of glioblastomas are surgery followed by radiotherapy and chemotherapy [4]. However, the prognosis of glioblastomas is poor and possibly due to its fatal location and high aggressiveness [5]. Therefore, it is urgent to elucidate molecular pathogenetic mechanism as well as discover novel therapy for glioblastomas patients.

MicroRNAs (miRNAs) are a short single-strand non-coding RNAs with about 22 nucleotides in length. MiRNA can bind directly to 3’ untranslated region (3’UTR) of target mRNA and formed RNA-induced silencing complex (RISC), negatively regulating gene expression at post-transcriptive level [6,7,8,9]. Recently studies have shown that miRNAs participate in many progresses of cancer such as proliferation, metastasis, recurrence and chemoresistance. Several recent studies have indicated that dysregulated miRNAs expression is also involved in pathogenesis of glioblastomas [10, 11]. MiR-3154 is a newly discovered miRNA which has been identified as prognostic biomarker for cervical cancer [12]. Other studies reported that miR-3154 is associated with acute myeloid leukemia [13, 14]. But whether it can regulate glioblastoma phenotype has not yet been reported.

In this study, we found that miR-3154 acted as a glioblastoma oncogene, promoted glioblastoma cell proliferation, invasion, and migration, and inhibited glioblastoma apoptosis. miR-3154 mechanically bound to the 3ʹUTR of TP53INP1, inhibited TP53INP1 expression, and further facilitated glioblastoma progression.

Results

Expression of miR-3154 was elevated in human glioblastoma tissues and cell lines

To explore the role of miR-3154 in glioblastoma, we first examined the expression of miR-3154 in glioblastoma tissues. Expression of miR-3154 was significantly elevated in human glioblastoma tissue compared with adjacent normal tissue (n = 28) (Fig. 1A). Besides, expression of miR-3154 was higher in I/II grade glioblastoma than normal tissue, and expression of miR-3154 in grade III/IV glioblastoma was further higher than I/II grade glioblastoma (Fig. 1B), which indicating that miR-3154 expression was associated with degree of malignancy. We then examined the expression of miR-3154 in normal human glial cell line HEB and glioblastoma cell lines. The basal level of miR-3154 was significantly elevated in all examined glioblastoma cell lines compared with normal cell line (Fig. 1C). Among examined glioblastoma cell lines, U251 and A172 had highest level of miR-3154 and was used for following experiments.

Fig. 1
figure 1

Expression of miR-3154 was elevated in human glioblastoma tissue and cell lines. A. Expression of miR-3154 in paired glioblastoma tissue and adjacent normal tissue (n = 28) detected by quantitative real-time polymerase chain reaction (qRT-PCR). *p < 0.05. B. Expression of miR-3154 in normal tissue, grade I/II glioblastoma, grade III/IV glioblastoma detected by qRT-PCR. *p < 0.05. C. Expression of miR-3154 in normal glial cell HEB and glioblastoma cell lines detected by qRT-PCR. *p < 0.05

Full size image

miR-3154 promotes glioblastoma cells proliferation

We next explore the function of miR-3154 in glioblastoma cells by constructing miR-3154 knockdown stable transfected U251 and A172 cell lines. The knockdown effect of miR-3154 sponge was examined by qRT-PCR (Fig. 2A). Proliferation ability reflected by CCK8 assay showed that miR-3154 knockdown significantly inhibited glioblastoma cells proliferation compared with its negative control cells (Fig. 2B). Consistently, colony formation assays showed that both miR-3154 sponge U251 and miR-3154 sponge A172 formed fewer colonies than negative control cells (Fig. 2C). One primary GBM cells showed the similar results (supplementary Fig. 1A-C). Additionally, miR-3154 sponge U251 and miR-3154 sponge A172 cells showed higher percentage of G0/G1 stage cells and lower percentage of G2/M stage cells by using flow cytometry, suggesting depletion of miR-3154 induce cell cycle arrest (Fig. 2D). In accordance with flow cytometry data, the protein expression of cell cycle protein cyclin D1, cyclin E1 and PCNA were significantly reduced in miR-3154 sponge U251 and A172 cells as compared with negative control cells (Fig. 2E). More importantly, miR-3154 knockdown U251 cells and control cells were inoculated into node-mice. miR-3154 knockdown U251 cells exhibited attenuated xenografted tumor growth, tumor size and tumor weight in vivo (Fig. 2F&G). The knockdown effect of miR-3154 sponge in formed xenografted tumors was further examined by qRT-PCR (Fig. 2H). Together, these data showed that miR-3154 promotes glioblastoma cells proliferating.

Fig. 2
figure 2

miR-3154 promotes glioblastoma cells proliferation. A. knockdown effect of miR-3154 sponge in U251 and A172 cell lines detected by qRT-PCR. *p < 0.05. B. Proliferation curve at indicated timepoint (24 h, 48 h, 72 h, 96 h) was measured by CCK8 assay. *p < 0.05. C. Photographs of colonies formed by miR-3154 sponge transfected cells and control cells were captured under microscope. D. Cell cycle analysis was performed on miR-3154 sponge transfected cells and control cells using flow cytometry. The percentage in histogram (left) are shown as bar chart (right). E. Protein expression of cyclin D1, cyclin E1 and PCNA were detected by western blot. F&G. U251 miR-3154 sponge or control cells (1 × 107) were subcutaneously injected into nude mice (n = 6) for xenograft assay. Tumor growth curve and average weight in each group was shown. H. Knockdown effect of miR-3154 sponge in xenografted tumors detected by qRT-PCR. *p < 0.05

Full size image

miR-3154 knockdown induces glioblastoma cells apoptosis

We next explore the potential role of miR-3154 in glioblastoma cell apoptosis. The proportion of apoptotic cells were significantly higher in miR-3154 sponge U251 cells than that of negative control U251 cells (Fig. 3A). Similarly, miR-3154 sponge A172 cells had markedly higher apoptotic rate than control A172 cells (Fig. 3B). PARP cleavage is a symbol of apoptosis and Bcl-2 is an oncoprotein that suppresses cell apoptosis. Western blot assay revealed that knockdown of miR-3154 induced cleavage PARP and reduced Bcl-2 expression (Fig. 3C). Collectively, these data suggested that miR-3154 prevents glioblastoma cells from apoptosis.

Fig. 3
figure 3

miR-3154 prevents glioblastoma cells from apoptosis. A. Apoptosis analysis was performed on miR-3154 sponge U251 cells and control U251 cells using flow cytometry. B. Apoptosis analysis was performed on miR-3154 sponge A172 cells and control A172 cells using flow cytometry. C. The protein expression of apoptosis symbol PARP and apoptosis suppressor Bcl-2 were detected by western blot

Full size image

miR-3154 promotes glioblastoma cells metastasis

Metastasis is one of pivotal characteristics of glioblastoma and we wonder whether miR-3154 play a potential role in glioblastoma cells metastasis. We found that the migration ability of miR-3154 sponge cells were significantly reduced than control cells (Fig. 4A&B). Invasion ability of miR-3154 sponge cells were also dramatically mitigated than control cells (Fig. 4C&D). Moreover, miR-3154 knockdown also impaired the migration and invasion ability of primary GBM cells (supplementary Fig. 2A&B). Epithelial-mesenchymal transition (EMT) is considered a crucial step in cancer metastasis [15]. miR-3154 sponge cells showed higher expression level of E-cadherin and lower expression level of Vimentin (Fig. 4E), suggesting that miR-3154 regulates EMT related genes expression. These data showed that miR-3154 promotes glioblastoma cells metastasis.

Fig. 4
figure 4

miR-3154 promotes glioblastoma cells metastasis. A. Migration ability of miR-3154 sponge U251 cells and control U251 cells was measured using Transwell assay. *p < 0.05. B. Migration ability of miR-3154 sponge A172 cells and control A172 cells was measured using Transwell assay. *p < 0.05. C. Invasion ability of miR-3154 sponge U251 cells and control U251 cells was measured using invasion assay. *p < 0.05. D. Invasion ability of miR-3154 sponge A172 cells and control A172 cells was measured using invasion assay. *p < 0.05. E. Protein expression of E-cadherin, Vimentin was detected using western blot for assessment of epithelial-mesenchymal transition (EMT)

Full size image

miR-3154 promotes glioblastoma cells proliferation and metastasis via targeting TP53INP1

We next explore the target genes through which miR-3154 regulate glioblastoma cells proliferation and metastasis. We used TargetScan to predict binding site of miR-3154 and found TP53INP1 as a potential target (Fig. 5A). To examine whether miR-3154 binds to TP53INP1 directly, we constructed luciferase reporter gene plasmid with wildtype TP53INP1 or mutant TP53INP1 ligating to 3’UTR of luciferase mRNA. As expected, relative luciferase activity of miR-3154 sponge cells exhibited higher luciferase activity compared with control cells when transfected with wildtype TP53INP1 luciferase reporter gene plasmid (Fig. 5B). On the contrary, transfection with mutant TP53INP1 luciferase reporter gene plasmid abrogates this discrepancy (Fig. 5B). This assay confirmed that miR-3154 directly binds to TP53INP1 3’UTR. In addition, miR-3154 knockdown up-regulated the mRNA and protein expression of TP53INP1(Fig. 5C&D). As expected, the subcutaneous xenografts of the miR-3154 knockdown U251 cells exhibited much higher TP53INP1 levels than their controls (supplementary Fig. 3A). Furthermore, we also observed that the expression of TP53INP1 in grade III/IV glioblastoma was further lower than I/II grade glioblastoma (supplementary Fig. 3B&C).

Fig. 5
figure 5

miR-3154 promotes glioblastoma cells proliferation and metastasis via targeting TP53INP1. A. 3’UTR of TP53INP1 was a predicted potential binding site of miR-3154 identified by TargetScan. Except wildtype TP53INP1, a mutant TP53INP1 was also constructed to disrupt the interaction between miR-3154 and TP53INP1 mRNA. B. Dual luciferase reporter gene assays were performed on U251 miR-3154 sponge or A172 miR-3154 sponge and their control cells transfected with wild-type or mutant TP53INP1 3’-UTR. *p < 0.05. C. mRNA expression of TP53INP1 was measured by qRT-PCR in miR-3154 sponge U251 or miR-3154 sponge A172 and control cells. *p < 0.05. D. Protein expression of TP53INP1 was measured by qRT-PCR in miR-3154 sponge U251 or miR-3154 sponge A172 and control cells. E. Proliferation ability of miR-3154 sponge or control cells transfected with si-TP53INP1 or si-NC were measured in both U251 and A172 cell lines at indicated timepoints using CCK8 assay. *p < 0.05. F. Proliferation ability of miR-3154 sponge or control cells transfected with si-TP53INP1 or si-NC were measured in U251 cell line using colony formation assay. G. Proliferation ability of miR-3154 sponge or control cells transfected with si-TP53INP1 or si-NC were measured in A172 cell line using colony formation assay. H. Migration ability of miR-3154 sponge or control cells transfected with si-TP53INP1 or si-NC were measured in U251 cell line using invasion assay. I. Migration ability of miR-3154 sponge or control cells transfected with si-TP53INP1 or si-NC were measured in A172 cell line using invasion assay. J&K. The indicated cells (1 × 107) were subcutaneously injected into nude mice (n = 6) for xenograft assay. Tumor growth curve and average weight in each group was shown. L. The expression of miR-3154 and TP53INP1 in xenografted tumors detected by qRT-PCR. *p < 0.05

Full size image

We next explore whether miR-3154 regulate glioblastoma cells proliferation and metastasis via TP53INP1. siRNA of TP53INP1 or negative control siRNA was transfected into miR-3154 sponge or control cells. As expected, TP53INP1 knockdown not only enhanced proliferation ability of both miR-3154 sponge cells and control cells, but also abrogated the proliferation discrepancy between miR-3154 sponge and control cells (Fig. 5E-G, supplementary Fig. 4A). In addition, the invasion ability was also enhanced in TP53INP1 knockdown glioblastoma cells, and interference of TP53INP1 eliminated the difference between miR-3154 sponge cells and control cells (Fig. 5H&I, supplementary Fig. 4B). More importantly, the in vivo proliferation capacity of miR-3154-knockdown glioblastoma cells could be restored through interference of TP53INP1 (Fig. 5J-L). These data collectively demonstrated that miR-3154 promotes glioblastoma cells proliferation and metastasis via downregulating TP53INP1.

Discussion

Glioblastoma is a highly fatal malignant cancer. The incidence rate of glioblastoma is low, around 6.6 cases per 100,000 individuals per year [16], but mortality rate, around 4.3 cases per 100,000 individuals per year, is high relative to its low incidence [16]. Glioblastoma can progress rapidly within several weeks, so early diagnosis or prevention is usually untenable [17]. Moreover, treatment decisions in glioblastoma patients depend on not only WHO grade but also selected molecular markers [18]. So, there is still an urgent need for elucidation of pathogenetic mechanism underlying glioblastomas. Our results demonstrated that miR-3154 was significantly up-regulated in glioblastoma tissues. MiR-3154 knockdown inhibited glioblastoma cells proliferation and metastasis via downregulating TP53INP1.

Previous studies have shown that miRNAs play an important role in glioblastoma biological processes. On the one hand, some miRNAs can promote glioblastoma cells proliferation and metastasis, such as miR-155-5p and miR-155-3p [10], MiR-1290 [19], miR-130b [20]. On the other hand, some miRNAs can inhibit glioblastoma cells proliferation and invasion, such as miRNA-451 [21] and miR-125a-3p [11]. MiR-3154 was a newly discovered miRNA and was up-regulated in cervical cancer and leukemia [12,13,14], suggesting that miR-3154 may serve as an oncogenic miRNA. Our data showed that miR-3154 was also up-regulated in glioblastoma tissue and cell lines. In addition, elevated miR-3154 expression correlated with degree of malignancy. miR-3154 knockdown glioblastoma cells showed retarded cell proliferation, arrested cell cycle, increased apoptosis, and reduced metastasis. Our data indicated that miR-3154 acts as a pro-oncogenic miRNA in glioblastoma.

TP53INP1 was a p53 induced gene involved in p53-dependent cell death, cell-cycle arrest and cellular migration [22]. TP53INP1 was recognized as a tumor suppressor gene [23]. Silence of TP53INP1 by several miRNAs such as hsa-miR-569 [24] and miR-130b [25] is a major type of mechanism of tumor progression. Here, our data revealed that another miRNA, miR-3154, binds directly to 3’UTR of TP53INP1. miR-3154 negatively regulated TP53INP1 expression at both mRNA and protein level. In addition, silence of TP53INP1 abolish the discrepancy of proliferation and metastasis between miR-3154 knockdown glioblastoma cells and control cells. These data suggest that miR-3154 promotes glioblastoma proliferation and metastasis by inhibiting TP53INP1, and enrich experimental basis for regulatory network of miRNA-TP53INP1.

In this study, we for the first time demonstrated that miR-3154 was elevated in glioblastoma tissues and cell lines. Knockdown of miR-3154 inhibits glioblastoma proliferation and metastasis. Mechanistically, miR-3154 binds directly to TP53INP1 3’UTR. Knockdown of miR-3154 upregulated TP53INP1 at both mRNA and protein level. Interference of TP53INP1 abolished the differences of proliferation and metastasis between miR-3154 sponge glioblastoma cells and control cells. Collectively, these findings indicated that miR-3154 promotes glioblastoma proliferation and metastasis via targeting TP53INP1, elucidating pathogenetic mechanism of glioblastoma. And our results present inklings that miR-3154 may serve as a new treatment target for glioblastoma patients.

Materials and methods

Tissue and samples

Glioblastoma inpatients receiving surgical resection at General Hospital of Northern Theater Command from 2015 to 2017 were recruited in this study. Detailed clinicopathological features of the patients in supplementary Table 1. Written inform consent was obtained from each patient and study plan was approved by Ethics Committee of General Hospital of Northern Theater Command.

Cell line and viruses

Normal glial cells and glioblastoma cell lines were obtained from cell bank of Chinese Science Academy, Shanghai. Glioblastoma cell lines U251 and A172 were cultured with 10% fetal bovine serum containing DMEM (Dulbecco’s Modified Eagle Medium) at cell incubator set to 37℃ and 5% CO2. MiR-3154 sponge lentivirus and control viruses and siRNA of TP53INP1 and negative control were purchased from GenePharma, Shanghai. miR-3154 sponge is a fragment of mRNA which carries miR-3154 complementary sequence in its 3’UTR. Thus miR-3154 sponge can absorb and prevent miR-3154 from binding to its natural target.

Cell proliferation assays

For CCK8 assay, cells were seeded into 96-well plates at a density of about 3 × 103 cells per well in 100 µl medium. Cells were incubated for indicated length of time (24 h, 48 h, 72 h 96 h). 10µL Cell Counting Kit-8 was added to each well following instruction and incubated for 30 min. Absorbance at 450 nm was measured using a microplate reader.

For colony formation assay, cells were seeded into 96-well plates at a density of about 3 × 103 cells per well in 2 ml medium. After 7 days culture these cells were fixed in 10% formaldehyde and dyed with crystal violet (Beyotime). The cells were washed before photographed under a microscope (Olympus, Tokyo, Japan).

Animal model

Six-to-eight-week-old male BALB/c nude mice from Chinese Academy of Sciences Slake were used for all experiments in this work. BALB/c nude mice were reared at 26 ℃ and 50% humidity. For tumor growth in vivo, 1 × 107 U251 cells were implanted subcutaneously in the flanks of BALB/c nude mice (six animals/each group, mice random assignment). The mice were checked regularly for tumor size at the indicated time points. The tumor-bearing mice were sacrificed 5 weeks post-implantation, and tumor weights were measured. All experiments involving mice were undertaken in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and the approval of the Institutional Animal Care and Use Committee (IACUC) at General Hospital of Northern Theater Command.

Cell metastasis assays

For cell migration experiments, cells were seeded into the upper chamber of a polycarbonate transwell chamber at a density of about 2 × 105 cells per well in serum-free DMEM. DMEM with 20% FBS was added to the lower chamber. Cells were incubated for 12 h. The chamber was taken out and fixed in 10% formaldehyde for 12 h and dyed with crystal violet (Beyotime). Cells were washed before photographed under a microscope (Olympus, Tokyo, Japan) and cell number is expressed as the average number of cells per visual field.

For cell invasion experiments, cells were seeded into the upper chamber of a Boyden chamber coated with Matrigel (BD) at a density of about 2 × 105 cells per well in serum-free DMEM. DMEM with 20% FBS was added to the lower chamber. Cells were incubated for 12 h. The chamber was taken out and fixed in 10% formaldehyde for 12 h and dyed with crystal violet (Beyotime). Cells were washed before photographed under a microscope (Olympus, Tokyo, Japan) and cell number is expressed as the average number of cells per visual field.

Quantitative real-time PCR

Total RNA was extracted and reversely transcribed using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using TaqMan MicroRNA assay kits (Applied Biosystems). Results of miR-3154 and TP53INP1 were detected using U6 snRNA or β-actin as internal reference. The U6 primer sequences were forward: 5’ ATTGGAACGATACAGAGAAGATT 3’. The TP53INP1 primer sequences were forward: 5’ CCCCACCCCCATGTTTTACT 3’, reverse: 5’ TTTCCTGGCCCTGGGACTAC 3’. The β-actin primer sequences were forward: 5’ GGCCCAGAATGCAGTTCGCCTT 3’, reverse: 5’ AATGGCACCCTGCTCACGCA 3’.

Luciferase reporter gene assay

The wide type or mutant TP53INP1 3’-untranslated regions (UTR) was cloned into the luciferase reporter plasmid pGL4.13 vector (Promega). miR-3154 sponge or control virus stable-transfected cells were transfected with dual luciferase reporter plasmid vector containing wild type or mutate TP53INP1 using lipofectamine 2000 (Invitrogen, NY, USA). Cells were incubated for 48 h, and relative luciferase activity was measured using Renilla luciferase activity as internal reference.

Western blot assay

Cells were lysed in ice-cold lysis buffer. Lysates were ultrasonicated on ice at 25% intensity for a total of 20 s before centrifugation at 12,000 rpm for 15 min at 4 °C. Protein concentration in each supernatant was measured using a BCA method. Proteins were denatured by boiling for 5 min in sodium dodecyl sulfate (SDS) sample buffer. 25 µg protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to the nitrocellulose (NC) membrane. NC membrane was blocked in 5% nonfat milk and incubated with indicated primary antibody. Primary antibodies were seen via binding IRDye 800CW-conjugated secondary antibody. The LI-COR imaging system (LI-COR Biosciences) was used to detect fluorescein intensity. The primary antibodies were cyclin D1 (1:1000; # 55506, Cell Signaling Technology), cyclin E1 (1:1000; # 4129, Cell Signaling Technology), PCNA (1:1000; # 13110, Cell Signaling Technology), PARP (1:1000; # 9532, Cell Signaling Technology), Bcl-2 (1:1000; # 15071, Cell Signaling Technology), E-cadherin (1:1000; # 14472, Cell Signaling Technology), Vimentin (1:1000; #5741, Cell Signaling Technology), TP53INP1 (1:1000; ab202026, abcam), and β-actin (1:5000; # 3700, Cell Signaling Technology).

Immunohistochemistry staining

The tissue samples were fixed with 10% neutral formaldehyde, embedded in paraffin, and sectioned for immunohistochemical (IHC) staining as described previously [26]. In brief, after antigen retrieval, sections or tissue microarrays (TMAs) were blocked with bovine serum antigen albumin (BSA) and incubated with the indicated primary antibody and then secondary antibody. A diaminobenzidine (DAB) colorimetric reagent solution was used, followed by hematoxylin counterstaining. The slides were scanned, and representative images were captured. IHC scoring was based on the percentage of positively stained cells, and staining intensity was assessed by Image Scope software (Aperio Technologies, Inc.).

Flow cytometry

For cell cycle analysis, cells were collected and fixed with 75% ethanol at 4℃ overnight. Then cells were washed with PBS and incubated with FxCycle PI RNase solution (Thermo Fisher) for 15 min. Proportion of G0/G1, S, G2/M phase cells were detected using Attune NxT flow cytometry (Thermo Fisher).

For apoptosis assay, cells were collected and washed with PBS before incubating with FITC labeled Annexin V and PI (Beyotime) for 15 min. Proportion of Annexin V positive cells were detected using Attune NxT flow cytometry (Thermo Fisher).

Statistical analysis

All statistical analyses were performed using SPSS software or GraphPad Prism software. Student’s t-test was applied to compare difference between two groups and p value smaller than 0.05 is considered statistically significant.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Weller M, Wick W, Aldape K, Brada M, Berger M, Pfister SM, Nishikawa R, Rosenthal M, Wen PY, Stupp R et al. Glioma. Nat Rev Dis Primers 2015;1:15017.

  2. Weller M, van den Bent M, Tonn JC, Stupp R, Preusser M, Cohen-Jonathan-Moyal E, Henriksson R, Le Rhun E, Balana C, Chinot O, et al. European Association for Neuro-Oncology (EANO) guideline on the diagnosis and treatment of adult astrocytic and oligodendroglial gliomas. Lancet Oncol. 2017;18(6):e315–29.

    Article  PubMed  Google Scholar 

  3. Reifenberger G, Wirsching HG, Knobbe-Thomsen CB, Weller M. Advances in the molecular genetics of gliomas - implications for classification and therapy. Nat Reviews Clin Oncol. 2017;14(7):434–52.

    Article  CAS  Google Scholar 

  4. Lim M, Xia Y, Bettegowda C, Weller M. Current state of immunotherapy for glioblastoma. Nat Reviews Clin Oncol. 2018;15(7):422–42.

    Article  CAS  Google Scholar 

  5. Weller M, van den Bent M, Hopkins K, Tonn JC, Stupp R, Falini A, Cohen-Jonathan-Moyal E, Frappaz D, Henriksson R, Balana C, et al. EANO guideline for the diagnosis and treatment of anaplastic gliomas and glioblastoma. Lancet Oncol. 2014;15(9):e395–403.

    Article  PubMed  Google Scholar 

  6. Chen PS, Su JL, Hung MC. Dysregulation of microRNAs in cancer. J Biomed Sci. 2012;19:90.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Ma L. MicroRNA and metastasis. Adv Cancer Res. 2016;132:165–207.

    Article  CAS  PubMed  Google Scholar 

  8. Thorsen SB, Obad S, Jensen NF, Stenvang J, Kauppinen S. The therapeutic potential of microRNAs in cancer. Cancer J. 2012;18(3):275–84.

    Article  CAS  PubMed  Google Scholar 

  9. Han T, Zheng H, Zhang J, Yang P, Li H, Cheng Z, Xiang D, Wang R. Downregulation of MUC15 by miR-183-5p.1 promotes liver tumor-initiating cells properties and tumorigenesis via regulating c-MET/PI3K/AKT/SOX2 axis. Cell Death Dis. 2022;13(3):200.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Wu X, Wang Y, Yu T, Nie E, Hu Q, Wu W, Zhi T, Jiang K, Wang X, Lu X, et al. Blocking MIR155HG/miR-155 axis inhibits mesenchymal transition in glioma. Neuro Oncol. 2017;19(9):1195–205.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. He J, Huang Z, He M, Liao J, Zhang Q, Wang S, Xie L, Ouyang L, Koeffler HP, Yin D, et al. Circular RNA MAPK4 (circ-MAPK4) inhibits cell apoptosis via MAPK signaling pathway by sponging miR-125a-3p in gliomas. Mol Cancer. 2020;19(1):17.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Zeng Y, Wang KX, Xu H, Hong Y. Integrative miRNA analysis identifies hsa-miR-3154, hsa-miR-7-3, and hsa-miR-600 as potential prognostic biomarker for cervical cancer. J Cell Biochem. 2018;119(2):1558–66.

    Article  CAS  PubMed  Google Scholar 

  13. Lee YG, Kim I, Oh S, Shin DY, Koh Y, Lee KW. Small RNA sequencing profiles of mir-181 and mir-221, the most relevant microRNAs in acute myeloid leukemia. Korean J Intern Med. 2019;34(1):178–83.

    Article  CAS  PubMed  Google Scholar 

  14. Chu YY, Ko CY, Wang SM, Lin PI, Wang HY, Lin WC, Wu DY, Wang LH, Wang JM. Bortezomib-induced miRNAs direct epigenetic silencing of locus genes and trigger apoptosis in leukemia. Cell Death Dis. 2017;8(11):e3167.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Han T, Xiang DM, Sun W, Liu N, Sun HL, Wen W, Shen WF, Wang RY, Chen C, Wang X, et al. PTPN11/Shp2 overexpression enhances liver cancer progression and predicts poor prognosis of patients. J Hepatol. 2015;63(3):651–60.

    Article  CAS  PubMed  Google Scholar 

  16. Ostrom QT, Gittleman H, Liao P, Rouse C, Chen Y, Dowling J, Wolinsky Y, Kruchko C, Barnholtz-Sloan J. CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2007–2011. Neuro-Oncol 2014;16 Suppl 4(Suppl 4):iv1–63.

  17. Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2021. CA Cancer J Clin. 2021;71(1):7–33.

    Article  PubMed  Google Scholar 

  18. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021. May;71(3):209-249.

  19. Yan L, Cai K, Sun K, Gui J, Liang J. MiR-1290 promotes proliferation, migration, and invasion of glioma cells by targeting LHX6. J Cell Physiol. 2018;233(10):6621–9.

    Article  CAS  PubMed  Google Scholar 

  20. Xiao ZQ, Yin TK, Li YX, Zhang JH, Gu JJ. miR-130b regulates the proliferation, invasion and apoptosis of glioma cells via targeting of CYLD. Oncol Rep. 2017;38(1):167–74.

    Article  CAS  PubMed  Google Scholar 

  21. Nan Y, Guo H, Guo L, Wang L, Ren B, Yu K, Huang Q, Zhong Y. MiRNA-451 inhibits Glioma Cell Proliferation and Invasion through the mTOR/HIF-1α/VEGF signaling pathway by targeting CAB39. Hum gene Therapy Clin Dev. 2018;29(3):156–66.

    Article  CAS  Google Scholar 

  22. Okamura S, Arakawa H, Tanaka T, Nakanishi H, Ng CC, Taya Y, Monden M, Nakamura Y. p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis. Mol Cell. 2001;8(1):85–94.

    Article  CAS  PubMed  Google Scholar 

  23. Seillier M, Peuget S, Gayet O, Gauthier C, N’Guessan P, Monte M, Carrier A, Iovanna JL, Dusetti NJ. TP53INP1, a tumor suppressor, interacts with LC3 and ATG8-family proteins through the LC3-interacting region (LIR) and promotes autophagy-dependent cell death. Cell Death Differ. 2012;19(9):1525–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Chaluvally-Raghavan P, Zhang F, Pradeep S, Hamilton MP, Zhao X, Rupaimoole R, Moss T, Lu Y, Yu S, Pecot CV, et al. Copy number gain of hsa-miR-569 at 3q26.2 leads to loss of TP53INP1 and aggressiveness of epithelial cancers. Cancer Cell. 2014;26(6):863–79.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Ma S, Tang KH, Chan YP, Lee TK, Kwan PS, Castilho A, Ng I, Man K, Wong N, To KF, et al. miR-130b promotes CD133(+) liver tumor-initiating cell growth and self-renewal via tumor protein 53-induced nuclear protein 1. Cell Stem Cell. 2010;7(6):694–707.

    Article  CAS  PubMed  Google Scholar 

  26. Xiang DM, Sun W, Zhou T, Zhang C, Cheng Z, Li SC, Jiang W, Wang R, Fu G, Cui X, et al. Oncofetal HLF transactivates c-Jun to promote hepatocellular carcinoma development and sorafenib resistance. Gut. 2019;68(10):1858–71.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by the grand from the National Natural Science Foundation of China (81802983).

Author information

Author notes

  1. Xiangdan Lin and Qiong Wu contributed equally to this work.

Authors and Affiliations

  1. Department of Neurosurgery, General Hospital of Northern Theater Command, 83 Wenhua Road, ShenHe District, Shengyang, Liaoning, 110016, China

    Xiangdan Lin, Wei Lei, Dongyang Wu, Jianchun Sheng, Guobiao Liang & Di Fan

  2. Department of Neurosurgery, The first affiliated hospital of Jinzhou medical university, Jinzhou, 121000, China

    Xiangdan Lin

  3. Department of Thoracic Surgery, General Hospital of Northern Theater Command, NO.83 Wenhua Road, ShenHe District, Shenyang, 110016, China

    Qiong Wu

  4. Department of General Surgery, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China

    Guojun Hou

Authors
  1. Xiangdan Lin
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Qiong Wu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Wei Lei
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Dongyang Wu
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Jianchun Sheng
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Guobiao Liang
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Guojun Hou
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Di Fan
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

XL, QW and DF conducted all experiments and analyzed the data. WL and DW provided clinical samples. JS provided pathology evaluation and GL analyzed clinical data. GH provided support with experimental techniques. XL wrote the manuscript and DF contributed to the revision. DF conceived the project and supervised all experiments. All authors read and approved the manuscript.

Corresponding author

Correspondence to Di Fan.

Ethics declarations

Ethical approval

The present study was approved by the Ethical Committee of the General Hospital of Northern Theater Command.

Patient consent for publication

Not required.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Lin, X., Wu, Q., Lei, W. et al. miR-3154 promotes glioblastoma proliferation and metastasis via targeting TP53INP1. Cell Div 19, 30 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13008-024-00134-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13008-024-00134-w

Keywords

Cell Division

ISSN: 1747-1028

Contact us